Inciclopedia:VPD/Archivo36

From Inciclopedia
Jump to navigation Jump to search

General

Friendzone

A favor.png Nomino Loco.gif Headcrab Ravenholm logo.pngThe Freemaiden 22:20 27 may 2013 (UTC)

A favor.png Me gusta (pero para destacado, nada más) Gil Culiao (discusión) 22:35 27 may 2013 (UTC)
A favor.png A favor Muy Bueno. --Dalek.png Dalek »Exterminate Exterminate Exterminate 22:46 27 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 23:38 27 may 2013 (UTC)
En contra.png En contra. Le falta.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 00:32 28 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 19:54 28 may 2013 (UTC)
A favor.png Lo quiero sólo como destacado. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 20:24 28 may 2013 (UTC)
A favor.png A favor de que Maricardo deje salir al artículo de su Friendzone /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 09:41 30 may 2013 (UTC)
Comentario.png Comentario Lo haré cuando salgas del clóset. Es que es simpático y todo pero no hay feeling Listillo.gif.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 03:45 31 may 2013 (UTC)
En contra.png En contra. Como dije a la hora de juzgarlo en el concurso, no tiene algo original que lo haga especial. --Trespatines.jpg>>José Candelario Tres Patines ~ ¡A la reja! 00:56 10 jun 2013 (UTC)
A favor.png A favor--Argentoinciclope (discusión) 13:59 19 jun 2013 (UTC)
A favor.png A favor Efgsig1.pngAlSAYITEfgsig2.png 07:39 3 jul 2013 (UTC)
A favor.png A favor --IconoF1.gif Gudproyect Ajedrez1.jpg (¡Alcánzame!) Boxes 00:22 24 jul 2013 (UTC)
Candado.png Destacado. Gil Culiao (discusión) 06:47 29 jul 2013 (UTC)

Nyan Cat Nyancat.gif

A favor.png Nomino No sé si es muy friki para la portada Alucina.gif, pero me gustó.--Argentoinciclope (discusión) 19:35 4 jul 2013 (UTC)

En contra.png NEIN NEIN NEIN. Está bueno, pero por el formato perdería el 50% de su gracia en la portada :/ Gil Culiao (discusión) 22:43 10 jul 2013 (UTC)
A favor.png A favor --Lucifer BaphSmBK.gifFuego-5.jpg Invócame 10:51 11 jul 2013 (UTC)
En contra.png Coincido con Gil
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:46 20 jul 2013 (UTC)
Comentario.png Normalmente no doy votos en contra... pero En contra.png Voy a hacer una excepción Hermética-Logo01.png »Otro Día para Ser 01:21 24 jul 2013 (UTC)
En contra.png Creo que es muy gracioso pero el formato no es el indicado para la portada ¿Se podría nominar a otro tipo de reconocimiento?--Psychotycho666666 (discusión) 03:13 25 jul 2013 (UTC)
Candado.png Nope. Gil Culiao (discusión) 21:57 25 jul 2013 (UTC)

Los hombres son golpeados por el fútbol

A favor.png Nomino Risa.gif Headcrab Ravenholm logo.pngThe Freemaiden 22:20 27 may 2013 (UTC)

A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 22:44 27 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 19:54 28 may 2013 (UTC)
A favor.png A favor--Argentoinciclope (discusión) 14:20 29 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 13:46 30 may 2013 (UTC)
A favor.png A favor, aunque me gustó más la versión con George C. Scott. Gil Culiao (discusión) 03:37 4 jun 2013 (UTC)
A favor.png Check
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 19:48 6 jun 2013 (UTC)
A favor.png A favor. En Rusia Soviética, los balones de fútbol te golpean A TÍ.--Quiri (discusión) 08:51 2 jul 2013 (UTC)
Comentario.png Hola, vengo a sacar el flamewar. Básicamente el famoso de doblajes latinos vs Doblajes españoles. Yo pondría el título en inglés para evitarlo. Aun así, A favor.png A favor del Oscar /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 12:19 2 jul 2013 (UTC)
Comentario.png Esa flamewar ya fue hace rato, la comunidad (excepto algún que otro colgado) aprendió a aceptar las diferencias entre ambos doblajes y las diferentes terminologías e incluso se empezó a adoptar un español medianamente neutro en la mayoría de los artículos. Incluso yo, que soy argentino, en algunos artículos uso expresiones del otro lado del charco. Así que a armar bardo a otro lado pibe :P jajajajaja Headcrab Ravenholm logo.pngThe Freemaiden 03:45 9 jul 2013 (UTC)
Comentario.png Gallegos de mierda.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 07:15 12 jul 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:39 22 jul 2013 (UTC)

Testigos de Jehová

A favor.png Nomino. Eróticamente Heréticamente sublime Descj.PNG Gil Culiao (discusión) 20:06 21 jun 2013 (UTC)

A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 22:20 21 jun 2013 (UTC)
A favor.png Disculpe, ¿no quiere oir la palabra de Dios? --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 16:35 22 jun 2013 (UTC)
A favor.png Necesita sangre? Qué pena. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 17:45 22 jun 2013 (UTC)
A favor.png En contra
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 18:38 22 jun 2013 (UTC)
A favor.png A favor Qué cagada que sepan dónde vive cada uno, no nos darán un puto día de pan... ¡Ni siquiera cuando estemos mirando porno GRATIS, la puta madre! Wtf.gif Hermética-Logo01.png »Otro Día para Ser 00:16 25 jun 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 20:43 26 jun 2013 (UTC)
A favor.png Abre la puerta decían... será divertido decían...
  1. REDIRECT Usuario:Dave Yerushalaim/firma.js 22:03 27 jun 2013 (UTC)
A favor.png A favor de que toquen la puerta de la casa de un vendedor de productos Herbalife Maraletovio (Peleadera) 00:18 2 jul 2013 (UTC)
A favor.png A favor --IconoF1.gif Gudproyect Ajedrez1.jpg (¡Alcánzame!) Boxes 16:07 14 jul 2013 (UTC)
A favor.png A favor--The Prodigy logo.jpg The Prodigy Argento »Firestarter 16:33 14 jul 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 06:38 15 jul 2013 (UTC)

Francisco (papa)

A favor.png Nomino primer lugar del inciconcurso. Blue box.png The Doctor ¿Who? - 01:16 23 abr 2013 (UTC)

A favor.png Down with the argento papa Hermética-Logo01.png »Otro Día para Ser 02:26 23 abr 2013 (UTC)
A favor.png De puño y letra Avatar Lekxter: ( WT.gifMaestro Agua |EK.gifHumor-Control |FN.pngLa Guerra |Trisquel.pngEstado Avatar ) 03:59 23 abr 2013 (UTC)
A favor.png Papi, papi, papi chulo --Marki (discusión) 15:59 23 abr 2013 (UTC)
A favor.png Hay papa argentino Messi numero uno, reina Maxima, solo falta un mundial y ya está. --Argentoinciclope (discusión) 14:11 28 abr 2013 (UTC)
En contra.png En contra. Parece escrito por un K fanático :S --Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 23:52 28 abr 2013 (UTC)
Comentario.png Uh, eso es un golpe bajo Alucina.gif Avatar Lekxter: ( WT.gifMaestro Agua |EK.gifHumor-Control |FN.pngLa Guerra |Trisquel.pngEstado Avatar ) 02:09 29 abr 2013 (UTC)
Comentario.png Peor sería escrito por un macrista. Y A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden
Comentario.png Comentario. Lo dices sólo porque eres de River Burla.gif.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 09:55 5 may 2013 (UTC)
En contra.png En contra. No me termina de convencer, ademas lo encontré un poco difícil de seguir. --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:39 5 may 2013 (UTC)
En contra.png Está bueno, pero... lo encontré muy local, muy argento como para la portada. Aún así está bueno --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 18:51 10 may 2013 (UTC)
A favor.png A favor--Fandemampato (discusión) 02:54 11 may 2013 (UTC)
A favor.png Bless this article --Trespatines.jpg>>José Candelario Tres Patines ~ ¡A la reja! 01:04 10 jun 2013 (UTC)
En contra.png En contra me parece un poco clichero y poco gracioso, o al menos le falta sarcasmo. --Lucifer BaphSmBK.gifFuego-5.jpg Invócame 00:07 16 jun 2013 (UTC)
En contra.png A favor de verlo en la portada argentina. Gil Culiao (discusión) 00:40 11 jul 2013 (UTC)
Candado.png No será Blue box.png The Doctor ¿Who? - 03:11 12 jul 2013 (UTC)

Constitución Inciclopédica

A favor.png Nomino porque los Inciclopedistas tienen derecho a conocer sus deberes. --Marki (discusión) 13:44 17 abr 2013 (UTC)

En contra.png Muy interno. --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:41 5 may 2013 (UTC)
En contra.png Ídem Headcrab Ravenholm logo.pngThe Freemaiden 03:54 7 may 2013 (UTC)
A favor.png A favor --JaimeABM (discusión) 20:32 14 may 2013 (UTC)
A favor.png Han habido articulos mucho más internos o de temas mucho más cerrados destacados. No veo razón para no destacarlo :P /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 20:56 14 may 2013 (UTC)
A favor.png A favor gran obra filoctética. Blue box.png The Doctor ¿Who? - 07:16 18 may 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 21:52 21 may 2013 (UTC)
A favor.png Ídem de Ken.. Hermética-Logo01.png »Otro Día para Ser 06:12 2 jun 2013 (UTC)
Candado.png Lo que no fue, no será Blue box.png The Doctor ¿Who? - 03:11 12 jul 2013 (UTC)

Scott Pilgrim

A favor.png Autonomino sólo porque Scott es awesome Mola.gif --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 16:02 12 jun 2013 (UTC)

Comentario.png Ya casi llegas al nivel de destacado, pero todavía no :). Blue box.png The Doctor ¿Who? - 16:02 4 jul 2013 (UTC)
Comentario.png Forever Alone.png Ya casi... --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 15:22 5 jul 2013 (UTC)
En contra.png En contra :( --Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 23:17 5 jul 2013 (UTC)
Candado.png No será Gil Culiao (discusión) 19:33 9 jul 2013 (UTC)

Inception

A favor.png Empezada por mi terminada por el genio de Darko. --Dalek.png Dalek »Exterminate Exterminate Exterminate 21:23 21 may 2013 (UTC)

A favor.png ...Noooooon, je ne regrette rieeeen... Gil Culiao (discusión) 21:44 21 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:08 23 may 2013 (UTC)
A favor.png Excelente Headcrab Ravenholm logo.pngThe Freemaiden
Comentario.png Maiden, por favor, por pereza que te dé, haz el favor de iniciar sesión para votar, que no sabemos si estás votando tú o un troll... que a mi ya me colaron un voto falso en mi nombre... Supongo que eres tú esa IP porque acostumbras a hacerlo. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:52 23 may 2013 (UTC)
Comentario.png Comentario Fer (disc. · contr. (borradas) · nºed. · reg. · bloq.) hacía lo mismo :P Headcrab Ravenholm logo.pngThe Freemaiden 21:18 23 may 2013 (UTC)
Comentario.png Comentario ¿Y si Fer se cambia de sexo? Blue box.png The Doctor ¿Who? - 08:49 30 may 2013 (UTC)
Comentario.png No creo que... ¿o sí, señora Maiden? --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:21 30 may 2013 (UTC)
Comentario.png Marcsances tiene razón. Emoticon chatzilla serio.png.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 22:57 23 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 19:54 28 may 2013 (UTC)
A favor.png Voto a favor de A favor.png estar a favor de A favor.png estar a favor de A favor.png estar a favor de A favor.png estar a favor ... de destacar esto.
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:23 30 may 2013 (UTC)
A favor.png A favor--Argentoinciclope (discusión) 13:42 5 jun 2013 (UTC)
A favor.png A favor Excepcional. Peón.jpg DJ Nietzsche 11:49 2 jul 2013 (UTC)
A favor.png A favor Que quede destacado dentro de un destacado /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 12:20 2 jul 2013 (UTC)
A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 16:38 2 jul 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 01:53 8 jul 2013 (UTC)

San Ernesto de La Higuera

A favor.png Me sumo a las autonominaciones en nombre de la Patria, el Socialismo y la Santa Muerte, amén. Gil Culiao (discusión) 22:11 1 abr 2013 (UTC)

A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 22:16 1 abr 2013 (UTC)
A favor.png A favor No sé cómo pude olvidarlo cuando revisé los destacados locales destacables, bueno, me hacen falta revisar muchos. Blue box.png The Doctor ¿Who? - 00:18 2 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:09 20 abr 2013 (UTC)
A favor.png A favor
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 10:15 5 may 2013 (UTC)
A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden 03:54 7 may 2013 (UTC)
Candado.png Destacado por antigüedad. Gil Culiao (discusión) 18:27 1 jul 2013 (UTC)

Pitbull

A favor.png Nomino Risa.gif --Dalek.png Dalek »Exterminate Exterminate Exterminate 03:15 10 jun 2013 (UTC)

A favor.png Ya tu sabeh
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 08:35 10 jun 2013 (UTC)
A favor.png Voto remixeado
  1. REDIRECT Usuario:Dave Yerushalaim/firma.js 13:56 10 jun 2013 (UTC)
A favor.png Que no pare la fiesta, dont stop the partyyy!! --Argentoinciclope (discusión) 16:32 10 jun 2013 (UTC)
A favor.png En contra, éste tipo de música no me gusta. Blue box.png The Doctor ¿Who? - 00:20 11 jun 2013 (UTC)
Prorrogar.png ¿No te diste cuenta que usaste el botón incorrecto? --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 10:13 11 jun 2013 (UTC)
Comentario.png Alguien necesita un letrero.
  1. REDIRECT Usuario:Dave Yerushalaim/firma.js 14:29 11 jun 2013 (UTC)
Comentario.png Sí, tú, porque no viste que puse prorrogar. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 18:53 12 jun 2013 (UTC)
A favor.png A favor. Sonreír.PNG--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 19:20 12 jun 2013 (UTC)
A favor.png Guan, tú, tríh, foh! Uno, doh, treh, cuatro! --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 18:47 14 jun 2013 (UTC)
A favor.png Ai nou iu wont mi, iu nou ai woncha.. Hermética-Logo01.png »Otro Día para Ser 03:29 16 jun 2013 (UTC)
Candado.png Destacado.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 07:18 24 jun 2013 (UTC)

Francisco Morazán

A favor.png Nomino Blue box.png The Doctor ¿Who? - 07:02 25 mar 2013 (UTC)

A favor.png Da --Trespatines.jpg>>José Candelario Tres Patines ~ ¡A la reja! 20:39 25 mar 2013 (UTC)
A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 22:36 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:10 20 abr 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 01:06 7 may 2013 (UTC)
A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 00:34 28 may 2013 (UTC)
A favor.png A favor--Sonicfan44 (discusión) 06:37 16 jun 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:14 17 jun 2013 (UTC)

Eduardo Galeano

A favor.png Nomino Blue box.png The Doctor ¿Who? - 06:59 25 mar 2013 (UTC)

A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:03 28 abr 2013 (UTC)
En contra.png Meh, no me convence. --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:37 5 may 2013 (UTC)
A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 18:32 15 may 2013 (UTC)
En contra.png En contra Gil Culiao (discusión) 21:51 21 may 2013 (UTC)
Candado.png No fue Blue box.png The Doctor ¿Who? - 00:26 10 jun 2013 (UTC)

Los Inmisericordes Chiles de Quetzalzatenango

A favor.png Nomino Blue box.png The Doctor ¿Who? - 06:52 25 mar 2013 (UTC)

A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 13:59 30 mar 2013 (UTC)
A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 22:36 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:11 20 abr 2013 (UTC)
Comentario.png Sin conocer del tema, doy mi opinión crítica basándome en el tipo de humor, el diseño y la longitud, asi como en el hecho que ya tiene dos destacados locales. A favor.png A favor. --Marki (discusión) 13:06 21 abr 2013 (UTC)
A favor.png A favor --Poe2.jpg Usuario:Gabeatle ¬¬ 2 años después Ojo de osiris.gif 00:45 14 may 2013 (UTC)
Candado.png Destacao Blue box.png The Doctor ¿Who? - 00:24 10 jun 2013 (UTC)

Codex Gigas

A favor.png Autonomino. Del Inciconcurso. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 04:12 13 may 2013 (UTC)

A favor.png Excelso Blue box.png The Doctor ¿Who? - 04:17 13 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:36 13 may 2013 (UTC)
A favor.png HOYGAN algien save donde puedo encontrar la vercion en pdf es para un trabajo grasias de antecuello Gil Culiao (discusión) 02:03 14 may 2013 (UTC)
A favor.png A favor --Shabidoo (discusión) 06:15 21 may 2013 (UTC)
A favor.png io tambien necessito la vercion hen pedefe, si arguien la puede colgar seria jenial, grazias de hantepulgar --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:47 25 may 2013 (UTC)
Comentario.png Fihjénsen zI eZthÓ ø ExTHO lEz pÜedÉ ZeRbirr.. Lo que sí, creo que tienen que registrarse para descargarlo. Alucina.gif De nada Loco.gif y esepero los premios de gracias en mi discusión. Espero que les sirva.. Vale.gif Hermética-Logo01.png »Otro Día para Ser 18:07 25 may 2013 (UTC)
A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 01:02 27 may 2013 (UTC)
A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 00:33 28 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:31 3 jun 2013 (UTC)

Giganotosaurus

Comentario.png Pruebo suerte, no llega a ser extremadamente localista. Headcrab Ravenholm logo.pngThe Freemaiden 03:54 7 may 2013 (UTC)

En contra.png Siga jugando, yo no lo veo TAN bueno como para portada general... Para portada argentina sí, y seguramente salga y todo. Para general, no creo. Ya estuvo el argentinosaurio. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 06:15 10 may 2013 (UTC)
Comentario.png Ya salió en la local :P Y que haya estado Argentinosaurio no creo que tenga mucho que ver. Headcrab Ravenholm logo.pngThe Freemaiden 23:04 12 may 2013 (UTC)

Leonardo DiCaprio

A favor.png Autonomino. Hace seis meses que no escribía un articulo y quiero saber que piensa la gente, ademas faltan nominados. --Dalek.png Dalek »Exterminate Exterminate Exterminate 13:32 23 ene 2013 (UTC)

A favor.png A favor, aunque creo que le quedaría estupenda una infobox. --|v|/-\|3( 5/-\|\|(€5 (discusión) 15:13 26 ene 2013 (UTC)
En contra.png En contra. Le falta.---Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 22:04 31 ene 2013 (UTC)
En contra.png En contra Headcrab Ravenholm logo.pngThe Freemaiden 19:49 14 feb 2013 (UTC)
A favor.png A favor --Higuerillas (discusión) 15:51 15 feb 2013 (UTC)
A favor.png A favor /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 15:40 23 feb 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 06:58 10 mar 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 21:18 25 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:04 28 abr 2013 (UTC)
A favor.png A favor--Argentoinciclope (discusión) 15:09 9 may 2013 (UTC)
A favor.png LOL
  1. REDIRECT Usuario:Dave Yerushalaim/firma.js 21:50 14 may 2013 (UTC)
Comentario.png Si es destacado tras cinco meses, escribo un artículo sobre lo que sea a la salud del administrador que lo destaque. Chulo.gif --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 08:46 20 may 2013 (UTC)
Comentario.png Lo esperaré con emoción e ira Blue box.png The Doctor ¿Who? - 13:13 20 may 2013 (UTC)
Comentario.png O viene Lourdes, o mañana habrá una carrera por ver quién destaca primero el artículo. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:50 25 may 2013 (UTC)
A favor.png A favor --Shabidoo (discusión) 06:15 21 may 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 00:00 27 may 2013 (UTC)

31 minutos

A favor.png Nomino. Esta excelente Aplauso.gif, uno de los mejores artículos que he leído en un tiempo. Además casi todos conocen la seria --Dalek.png Dalek »Exterminate Exterminate Exterminate 15:05 9 may 2013 (UTC)

A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 16:12 9 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 18:39 9 may 2013 (UTC)
A favor.png Yo opino que el artículo debería estar articulizado para la Portada. Eso opino --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 19:27 9 may 2013 (UTC)
A favor.png Top-top-top-top-top-top-top... Gil Culiao (discusión) 03:59 10 may 2013 (UTC)
A favor.png No tengo ni la más reputa idea de esa serie, pero el artículo es la FUCKING POSTA. Headcrab Ravenholm logo.pngThe Freemaiden 04:10 10 may 2013 (UTC)
Comentario.png En serio Maiden no sabes de lo que te pierdes :) Blue box.png The Doctor ¿Who? - 04:27 10 may 2013 (UTC)
A favor.png Llevo meses aislado de la tele en un microclima dónde sólo se escucha la radio. Aún así, es una obra de arte. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 06:13 10 may 2013 (UTC)
A favor.png A favor Avatar Lekxter: ( WT.gifMaestro Agua |EK.gifHumor-Control |FN.pngLa Guerra |Trisquel.pngEstado Avatar ) 19:53 10 may 2013 (UTC)
A favor.png Excelente! Lo mejor que he leído en muchísimo tiempo, hace tiempo que no me reía tanto con algún chiste de este sitio. Lo mejor es que me leí el articulo con las voces de los personajes Risa.gif /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Muchaseles/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 19:02 12 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 00:38 13 may 2013 (UTC)
Comentario.png Faltaría uno sobre Las nоticias del guiñol. Creo que es lo mismo en versión española. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:47 13 may 2013 (UTC)
A favor.png A favor Necesitamos algo de dinamismo --Poe2.jpg Usuario:Gabeatle ¬¬ 2 años después Ojo de osiris.gif 00:45 14 may 2013 (UTC)
Candado.png Yo nunca vi televisión porque es muy fome Blue box.png The Doctor ¿Who? - 00:49 20 may 2013 (UTC)

Incilibros/Todo lo que siempre quiso saber de sus administradores

A favor.png Me gusta, tendrá referencias a Inciclopedia, pero me gusta (y contaron mas de lo que quería saber.). --Hola esta es mi aburrida firma (discusión) 02:51 9 abr 2013 (UTC)

A favor.png Me gusta--Fandemampato (discusión) 20:03 14 abr 2013 (UTC)
¡¡Eh, tú!! ¡¡Fandemampato (disc. · contr. (borradas) · nºed. · reg. · bloq.), a ver si pulsamos esta tecla ↵ dos veces la próxima vez!! :P - A favor.png El artículo es bueno... --Marki (discusión) 13:26 17 abr 2013 (UTC)
A favor.png A favor --IconoF1.gif Gudproyect Ajedrez1.jpg (¡Alcánzame!) Boxes 22:15 29 abr 2013 (UTC)
A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 04:43 1 may 2013 (UTC)
A favor.png Not bad Blue box.png The Doctor ¿Who? - 21:40 2 may 2013 (UTC)
A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden 03:54 7 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:36 10 may 2013 (UTC)
A favor.png A favor /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Muchaseles/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 19:39 12 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:28 13 may 2013 (UTC)

Nutella

A favor.png Nomino segundo lugar del inciconcurso. Blue box.png The Doctor ¿Who? - 01:16 23 abr 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 02:27 23 abr 2013 (UTC)
A favor.png Genial artículo Avatar Lekxter: ( WT.gifMaestro Agua |EK.gifHumor-Control |FN.pngLa Guerra |Trisquel.pngEstado Avatar ) 15:08 23 abr 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 13:39 24 abr 2013 (UTC)
A favor.png Delicioso y adictivo Gil Culiao (discusión) 21:17 25 abr 2013 (UTC)
A favor.png A favor, aunque soy más de Nocilla y le quito un punto al autor por ni siquiera mencionarla. --Marki (discusión) 06:21 26 abr 2013 (UTC)
A favor.png Gran sustancia y mejor droga. --IconoF1.gif Gudproyect Ajedrez1.jpg (¡Alcánzame!) Boxes 15:17 2 may 2013 (UTC)
A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:38 5 may 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 01:28 7 may 2013 (UTC)

Ancient Aliens

A favor.png Porque el autonominarlo no es mera casualidad... --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 00:29 16 abr 2013 (UTC)

A favor.png ALIENS, lo han nominado ALIENS. --Marki (discusión) 13:34 16 abr 2013 (UTC) Comentario.png Ahora que lo vuelvo a ver, igual sí que no es taaaan bueno. --Marki (discusión) 12:48 21 abr 2013 (UTC)
A favor.png Voto híbrido Mi papá marciano me obligó a votar aquí.
  1. REDIRECT Usuario:Dave Yerushalaim/firma.js 15:12 16 abr 2013 (UTC)
En contra.png Perdón, pero está muy lejos del nivel de destacado. Headcrab Ravenholm logo.pngThe Freemaiden 02:25 18 abr 2013 (UTC)
En contra.png Concuerdo con Eldoncella Gil Culiao (discusión) 22:36 18 abr 2013 (UTC)
En contra.png En contra --Dalek.png Dalek »Exterminate Exterminate Exterminate 04:06 1 may 2013 (UTC)
Candado.png No será (y todo por culpa de los aliens) Gil Culiao (discusión) 04:39 1 may 2013 (UTC)

El Padrino

A favor.png El artículo nos ofrece un humor que no podemos rechazar. --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:26 30 mar 2013 (UTC)

Comentario.png Comentario Este artículo dormirá con los peces si no le arreglan el formato. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 18:20 30 mar 2013 (UTC)
Comentario.png Si no se arregla el estilo, ni padrinos ni abuelitas. --Marki (discusión) 18:55 30 mar 2013 (UTC)
En contra.png Dejo mi voto, tomo los cannoli Gil Culiao (discusión) 21:17 25 abr 2013 (UTC)
Candado.png De nuevo, no será Blue box.png The Doctor ¿Who? - 01:05 29 abr 2013 (UTC)

Astrofísica

A favor.png Autonomino, una reliquia hecha junto a Aquel que posee las Tetas. Blue box.png The Doctor ¿Who? - 23:44 23 feb 2013 (UTC)

A favor.png Carl Sagan lo pide /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 01:47 24 feb 2013 (UTC)
A favor.png A favor Peón.jpg DJ Nietzsche 13:09 24 feb 2013 (UTC)
A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 23:19 25 feb 2013 (UTC)
En contra.png No me suelen gustar los artículos con galería... --Marki (discusión) 13:12 2 mar 2013 (UTC)
Comentario.png Comentario Está muy bueno pero voto a favor si alguien corrige algunos detalles ortográficos y gramaticales que tiene el artículo. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 13:45 24 mar 2013 (UTC)
Comentario.png Corregido en lo posible. Blue box.png The Doctor ¿Who? - 04:29 26 mar 2013 (UTC)
Entonces A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 22:27 26 mar 2013 (UTC)
A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 22:36 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:01 26 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:26 29 abr 2013 (UTC)

Yuri Gagarin

A favor.png A favor y autonomino Gloria al héroe soviético. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 13:26 2 abr 2013 (UTC)

A favor.png A favor Blue box.png The Doctor ¿Who? - 04:59 3 abr 2013 (UTC)
A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png ¡Viva la Rodina Mat! y a ver si la siguiente se nomina a Korolyov. --Quiri (discusión) 03:29 9 abr 2013 (UTC)
A favor.png A favor --Marki (discusión) 13:36 16 abr 2013 (UTC)
A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden 02:27 18 abr 2013 (UTC)
A favor.png Глория! Gil Culiao (discusión) 22:36 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:01 20 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:52 22 abr 2013 (UTC)

¡Cuánto cabrón!

A favor.png Nomino :trollface: A ver qué tal cae :yaoming: /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 11:44 13 feb 2013 (UTC)

En contra.png No es tan bueno como para portada :yaoming: pero lo vas a destacar igualmente... --Marki (discusión) 14:37 13 feb 2013 (UTC)
En contra.png Not comedy gold. --Trespatines.jpg>>José Candelario Tres Patines ~ ¡A la reja! 18:09 13 feb 2013 (UTC)
En contra.png En contra.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 18:28 13 feb 2013 (UTC)
En contra.png En contra--Dalek.png Dalek »Exterminate Exterminate Exterminate 18:41 14 feb 2013 (UTC)
A favor.png No sé, pero a mí Megusta.jpg Gil Culiao (discusión) 19:15 14 feb 2013 (UTC)
En contra.png En contra Headcrab Ravenholm logo.pngThe Freemaiden 19:49 14 feb 2013 (UTC)
A favor.png YOLO --Higuerillas (discusión) 15:51 15 feb 2013 (UTC)
Comentario.png Añadiré que con el troleo reciente, no anda bien la cosa... --Marki (discusión) 21:53 15 feb 2013 (UTC)
Comentario.png ¿Y? Se protege como se hizo con Obama: Inciclopedia:Políticas de protección :P /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 15:36 17 feb 2013 (UTC)
A favor.png Cuanto cáncer --IconoF1.gif Gudproyect Ajedrez1.jpg (¡Alcánzame!) Boxes 22:02 20 feb 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 21:11 23 feb 2013 (UTC)
A favor.png A favor/* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Muchaseles/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 00:19 4 mar 2013 (UTC)
Candado.png No fue :( Blue box.png The Doctor ¿Who? - 04:33 22 abr 2013 (UTC)

Tequila

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 07:03 25 mar 2013 (UTC)

A favor.png A favor, pero ¿a qué vino tanta nominación seguida? --Marki (discusión) 09:33 25 mar 2013 (UTC)
Comentario.png Comentario no es algo nuevo, cuando estaba activo yo hacía estas nominaciones cuando había muy pocos artículos en VPD. Blue box.png The Doctor ¿Who? - 23:07 25 mar 2013 (UTC)
Comentario.png Seh, esto está últimamente más inactivo que una biblioteca sin WiFi. --Marki (discusión) 09:27 26 mar 2013 (UTC)
A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 14:29 30 mar 2013 (UTC)
A favor.png A favor --Fandemampato (discusión) 23:45 5 abr 2013 (UTC)
A favor.png A favor, votando en el estado adecuado. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 17:31 7 abr 2013 (UTC)
A favor.png Néctar de los dioses mexicanos, principalmente de la Santa Muerte, dada a los mortales.. Hermética-Logo01.png »Otro Día para Ser 15:48 11 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 03:19 16 abr 2013 (UTC)

Locales

Argentina

Marcelo Tinelli

A favor.png Autonomino Espero que el trabajo de buenos frutos, pocos artículos te televisión hay en esta portada Santo.gif--Argentoinciclope (discusión) 00:47 1 may 2013 (UTC)

Comentario.png ¿Pocos artículos de televisión hay en ésta portada? ¿Y? No todos tienen que serlo... Votaría a favor, pero las imágenes del cabeza con los cachorritos y la de estilo MGM me perturban bastante... Alucina.gif Wtf.gif Hermética-Logo01.png »Otro Día para Ser 06:14 2 may 2013 (UTC)
Comentario.png Telo voy a explicar La idea de ponerle a Tinelli con el perro es para referir como que su cabeza es tan grande que tapa el artículo, lo de MGM lo elimino si te molesta.--Argentoinciclope (discusión) 11:25 2 may 2013 (UTC)
Comentario.png Primero: Ya de por sí, se dicen unas cuantas veces "cabezón", refiriéndose al parodiado, ¿no es suficiente? Segundo, es TU artículo: podés sacarle o meterle imágenes a tu gusto, siempre y cuando quede bien. Acá sólo se dan opiniones. Después vos verás qué le hacés... Por eso se llama Inciclopedia, la enciclopedia de libre contenido (o eso dicen) Hermética-Logo01.png »Otro Día para Ser 14:45 2 may 2013 (UTC)
Comentario.png "Libre de contenido" o "de libre contenido", esa es la cuestión. Y creo que le falta un repasito para el verde. Gil Culiao (discusión) 05:07 6 may 2013 (UTC)
Comentario.png ¡Ups! Escribí cualquier cosa... O, mejor dicho, escribí cualquier cosa... Alucina.gif Wtf.gif Hermética-Logo01.png »Otro Día para Ser 05:37 6 may 2013 (UTC)
A favor.png A favor.--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 04:17 1 jun 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 06:23 6 jun 2013 (UTC)
A favor.png A favor, pero no negaré que necesite un repaso antes de pasar por portada. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:16 6 jun 2013 (UTC)
Comentario.png Y voto a favor porque se lo merece, habiendo logrado que su primer artículo sobreviva, y este segundo sea de gran calidad, lo hacen un gran mérito. Cabe destacar también que no abandona el artículo, y lo continua perfilando. Es uno de estos usuarios joyeros que no producen en masa, pero lo que hacen lo retocan para que alcance la perfección. Y eso le da valor añadido a un artículo que aún necesita algunas mejoras, pero ya es más o menos bueno. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:20 6 jun 2013 (UTC)
A favor.png Mejoró bastante desde la última vez que lo vi.. lo tiene merecido. Loco.gif Hermética-Logo01.png »Otro Día para Ser 18:47 6 jun 2013 (UTC)
Comentario.png Igualmente.. El hecho de que haya dado mi luz verde sólo fue un voto de confianza. Simplemente fue una animación para que Argentoinciclope mejore su escritura y otras cosas más... Hermética-Logo01.png »Otro Día para Ser 12:28 26 jun 2013 (UTC)
Comentario.png Te lo agradezco igualmente me cuesta mucho tener un momento de creatividad. A vos te ha ocurrido con violencia y me tarda la inspiración--Argentoinciclope (discusión) 12:40 26 jun 2013 (UTC)
Comentario.png No es el único artículo... con que me ha pasado que la inspiración es bajada por un gomerazo como si fuera una paloma casera. Igualmente, rebusco en otros artículos o recurro a Wikipedia para parodiar lo que voy a hacer. Le pasó, le pasa y le pasará a cualquiera. Hermética-Logo01.png »Otro Día para Ser 00:15 27 jun 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Incinoticias:Crean laguna artificial en Capital Federal, Argentina

A favor.png Autonomino Headcrab Ravenholm logo.pngThe Freemaiden 06:50 3 abr 2013 (UTC)

A favor.png A favor Blue box.png The Doctor ¿Who? - 06:58 3 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 11:43 3 abr 2013 (UTC)
A favor.png lol /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 08:23 4 abr 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 04:34 10 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 02:11 1 jun 2013 (UTC)

Hombre lobo marino

A favor.png Autonomino Santo.gif Blue box.png The Doctor ¿Who? - 20:34 26 mar 2013 (UTC)

A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden 06:50 3 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 11:42 3 abr 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 13:30 8 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 15:42 11 abr 2013 (UTC)
Comentario.png Ay, lo que es... escribir y tomar al mismo tiempo. Te provoca ciertas cosas... Alucina.gif Wtf.gif Embarazoso.png Hermética-Logo01.png »Otro Día para Ser 13:07 12 abr 2013 (UTC)
Candado.png Destacado por antigüedad Blue box.png The Doctor ¿Who? - 00:25 1 may 2013 (UTC)

Bolivia

Lamento boliviano‎

A favor.png Nomino --Argentoinciclope (discusión) 16:56 14 jun 2013 (UTC)

A favor.png Nena, no te peines en la cama que los viajantes se van a atrasar --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 21:59 25 jun 2013 (UTC)
A favor.png ...
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 22:01 25 jun 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 00:26 2 jul 2013 (UTC)
A favor.png A favor Risa.gif Muy bueno. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 02:31 2 jul 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

El asesino del taxista

A favor.png Nomino /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Muchaseles/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 19:11 12 may 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 19:18 12 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 02:23 13 may 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 03:17 13 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 02:14 1 jun 2013 (UTC)

Presidente de Bolivia

A favor.png Nomino Blue box.png The Doctor ¿Who? - 04:23 14 mar 2013 (UTC)

A favor.png Me gusta--Fandemampato (discusión) 20:04 14 abr 2013 (UTC)
A favor.png A favor Gracioso aunque un poco corto y le falta alguna foto. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 18:35 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:02 26 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:28 1 may 2013 (UTC)

Brasil

Río Amazonas

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 03:16 23 may 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:06 23 may 2013 (UTC)
A favor.png Pleno al quince, quiero pleno al quince --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:23 23 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 02:33 1 jun 2013 (UTC)


Centroamérica

United Fruit Company

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 06:22 6 jun 2013 (UTC)

A favor.png A favorMi pueblo fue muy azotado por estos mequetrefes Pena.gif pero el artículo lo compensa Santo.gif ¡It's peanut butter jelly time!Me encanta verla bailar. Ven a bailar 01:20 12 jun 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:43 22 jun 2013 (UTC)
A favor.png A favor de derrocar gobiernos legítimos y masacrar gente para que todos podamos disfrutar de una rica ensalada de frutas. Gil Culiao (discusión) 18:34 26 jun 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Daniel Ortega

A favor.png No mino Blue box.png The Doctor ¿Who? - 15:16 19 may 2013 (UTC)

A favor.png Y otra y otra vez, triunfará Niiicaragua... Gil Culiao (discusión) 04:46 20 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:58 20 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 02:54 1 jun 2013 (UTC)

Chile

Incinoticias:Santiago se convierte en la nueva Atlántida

A favor.png Autonomglugluglu-- --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 04:42 5 jun 2013 (UTC)

A favor.png glgagl fglavor, y dgleberías hacergl otrglo sobrgle glas inundaciongles glen centrglo eurglopa. --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:23 6 jun 2013 (UTC)
A favor.png A favor con una pequeña mano de gato submarino. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 01:04 10 jun 2013 (UTC)
A favor.png A favglugluglu.. Wtf.gif Hermética-Logo01.png »Otro Día para Ser 14:05 10 jun 2013 (UTC)
Comentario.png 2 cosas: gracias Gatricio por la manito de gato, y Marki... creo que podría hacer lo mismo con Europa, no es mala idea ;) --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 02:40 11 jun 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 03:41 11 jun 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 01:32 12 jun 2013 (UTC)
Candado.png Glub, glub Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

31 minutos

A favor.png Nomino. Esta excelente Aplauso.gif --Dalek.png Dalek »Exterminate Exterminate Exterminate 15:03 9 may 2013 (UTC)

A favor.png A favor Faltaron en el ranking Top Top Top los Computadores de Paine Risa.gif Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 16:13 9 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 18:15 9 may 2013 (UTC)
A favor.png A favor Headcrab Ravenholm logo.pngThe Freemaiden 04:17 10 may 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 04:34 10 may 2013 (UTC)
A favor.png Top top top top top top top top top top Eso me pasa cada vez que nominan un artículo como éste, Tulio --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 18:37 10 may 2013 (UTC)
A favor.png A favor /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Muchaseles/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 19:12 12 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 03:03 1 jun 2013 (UTC)

Salvador Allende

A favor.png Semi-autonomino, tomé un artículo y le hice modificaciones hasta tratar de dejarlo bonito. Blue box.png The Doctor ¿Who? - 04:08 5 abr 2013 (UTC)

Comentario.png Comentario Hacia el final le veo problemas gramaticales y ortográficos. Si se arreglan enverdezco la votación. Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 14:16 7 abr 2013 (UTC)
Comentario.png Creo que arreglado, creo Blue box.png The Doctor ¿Who? - 00:46 14 abr 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 17:31 14 abr 2013 (UTC)
A favor.png Me gusta--Fandemampato (discusión) 20:06 14 abr 2013 (UTC)
A favor.png A favor Hardy-Logo-psd16689.png>>Jeff-Hardy-Fake-by-Dipset-psd19608.pngHardyboy ~ The Charismatic Enigma 15:50 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 05:20 20 abr 2013 (UTC)
Candado.png Venceremos, venceremos Blue box.png The Doctor ¿Who? - 00:32 1 may 2013 (UTC)

Colombia

Fernando Botero

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 03:05 30 may 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:59 30 may 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Pablo Escobar

A favor.png Nomino a San Pablo. Blue box.png The Doctor ¿Who? - 01:50 23 may 2013 (UTC)

A favor.png Pleno al quince, quiero pleno al quince --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:23 23 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:58 30 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 03:17 1 jun 2013 (UTC)

España

Pedro I de Castilla

A favor.png Nomino Gil Culiao (discusión) 07:23 26 dic 2012 (UTC)

A favor.png A favorcio /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 19:58 23 feb 2013 (UTC)
A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 14:18 7 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:58 28 abr 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 18:08 6 jun 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Extremoduro

A favor.png Amor, chorros de lefa /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 11:58 7 nov 2012 (UTC)

A favor.png Donde quede alguna flor, donde no haya policía. Headcrab Ravenholm logo.pngThe Freemaiden 18:50 7 nov 2012 (UTC)
A favor.png Salir, votar, el rollo de siempre... --Marki (discusión) 15:12 7 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:58 28 abr 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 21:46 2 may 2013 (UTC)
Candado.png Deestacado Blue box.png The Doctor ¿Who? - 03:33 1 jun 2013 (UTC)

Península Ibérica

A favor.png De lo mejor que he visto en tiempo /* #REDIRECT */mw.loader.load("//inciclopedia.org/w/index.php?title=Usuario:Erredece/Firma.js\u0026action=raw\u0026ctype=text/javascript"); 23:00 19 oct 2012 (UTC)

A favor.png A favor Gil Culiao (discusión) 23:36 19 oct 2012 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 07:44 16 mar 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 11:46 3 abr 2013 (UTC)
Candado.png Destacada Blue box.png The Doctor ¿Who? - 00:35 1 may 2013 (UTC)

El Equipo A-zores

A favor.png Autonomino. Porque a Bush le encanta que los planes no salgan bien. --Quiri (discusión) 04:36 14 abr 2013 (UTC)

Comentario.png Reitero, las nominaciones nuevas van arriba Blue box.png The Doctor ¿Who? - 06:04 14 abr 2013 (UTC)
Comentario.png A ver. Léete todos los artículos que fueron destacados antes. ¿Tú crees, verdaderamente, que el tuyo merece ser destacado? No es un artículo malo en el sentido estricto de la palabra, pero yo lo veo corto y algo insuficiente para llegar al rango de destacado. Especialmente el problema es que es corto. Quieres que no borren tus publicaciones, hay un listón. Quieres que encima las destaquen, el listón es MUCHO más alto. Creo que tienes que mejorar un poquito más tus artículos antes de autonominarlos. Si hasta yo me lo pienso seseinta veces antes de autonominar algún artículo mío. No votaré en contra, dejaré que otros opinen. --Marki (discusión) 08:23 14 abr 2013 (UTC)
En contra.png Hace 2 años atrás hubiera pegado más que ahora --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 14:36 29 abr 2013 (UTC)
En contra.png ... Headcrab Ravenholm logo.pngThe Freemaiden
En contra.png En contra y Candado.png Cerrado Gil Culiao (discusión) 22:24 29 abr 2013 (UTC)

Honduras

Ricardo Maduro

A favor.png Más que nada, darnos el orgullo de llenar un VPDL. Además, me gustó el estilo de poner texto alt. --

  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:40 23 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:42 22 jun 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Japón

Yu Yu Hakusho

A favor.png Semiautonomino, creado por IP's pero enchulado por varios, incluido un servidor. Blue box.png The Doctor ¿Who? - 08:01 5 abr 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:58 28 abr 2013 (UTC)
A favor.png A favor Gil Culiao (discusión) 04:28 10 may 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

República Otaku de Akihabara

A favor.png Autonomino a este país que quiere independizarse de Japón --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 22:00 22 abr 2013 (UTC)

A favor.png A favor Blue box.png The Doctor ¿Who? - 21:46 2 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 18:16 9 may 2013 (UTC)
Comentario.png Consulta: Debería nominarlo también en el Portal Países (como Territorio Especial) o daría bote ahí?? Digo, para revivir también su VPDL --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 21:22 14 may 2013 (UTC)
Comentario.png No veo por qué no Gil Culiao (discusión) 21:31 14 may 2013 (UTC)
Comentario.png Okale, gracias ;) --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 21:37 14 may 2013 (UTC)
A favor.png De nada Gil Culiao (discusión) 04:57 20 may 2013 (UTC)
A favor.png Shinogo shahei pinsei hachi hittei ni puta idea de lo que he dicho --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:27 23 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 04:16 1 jun 2013 (UTC)

Battle Royale

A favor.png Nomino Blue box.png The Doctor ¿Who? - 19:47 23 feb 2013 (UTC)

En contra.png Demasiadas listas para mi gusto. Abusar de las listas también es una forma de seppuku de un artículo. --Marki (discusión) 19:52 23 feb 2013 (UTC)
Candado.png No fue Blue box.png The Doctor ¿Who? - 06:51 1 jun 2013 (UTC)

Kamikaze

A favor.png Autonomino y me lanzo a ciegas. Gil Culiao (discusión) 06:19 28 dic 2012 (UTC)

A favor.png A favor --Dalek.png Dalek »Exterminate Exterminate Exterminate 03:49 26 ene 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 08:01 5 abr 2013 (UTC)
A favor.png [Inserte hombre bomba aquí] --Marki (discusión) 15:15 7 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 15:44 11 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:38 1 may 2013 (UTC)

Batalla de Guadalcanal

A favor.png Autonomino porque este sí tiene que ver con la historia de Japón.--Quiri (discusión) 04:56 13 mar 2013 (UTC)

En contra.png Listas, listas, listas, listas... Headcrab Ravenholm logo.pngThe Freemaiden 20:42 28 mar 2013 (UTC)
En contra.png Ay, Quiri... Gil Culiao (discusión) 22:02 1 abr 2013 (UTC)
En contra.png En contra. Ya que te gustan tanto las listas, si quieres te hago una lista de razones... --Marki (discusión) 15:13 7 abr 2013 (UTC)
Candado.png No será Blue box.png The Doctor ¿Who? - 01:44 11 abr 2013 (UTC)

México

La Gaviota

A favor.png Autonomino la primera dama más fashion. Blue box.png The Doctor ¿Who? - 08:03 26 mar 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:59 28 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 23:32 10 may 2013 (UTC) Comentario.png ¿Tanto te gustó el artículo? Risa.gif Gil Culiao (discusión) 23:36 10 may 2013 (UTC)
A favor.png A mi también me gustó mucho --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 17:26 6 jun 2013 (UTC)
A favor.png A favor Loko Robles Logo jaguares nuevo.png Discusión 03:11 9 jun 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Cruz Azul

A favor.png Autonomino y a favor. El último de los cuatro grandes que falta de ser destacado local. Loko Robles Logo jaguares nuevo.png Discusión 23:10 7 feb 2013 (UTC)

A favor.png A favor Blue box.png The Doctor ¿Who? - 09:09 23 feb 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:59 28 abr 2013 (UTC)
A favor.png A favor Jahguar.png>>JAHGUAR Logosjaguares.gif ~ DIME JAHGUAR CÓMO LLEGAR HASTA EL FINAL 04:48 6 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 04:47 1 jun 2013 (UTC)

Tigres de la UANL

A favor.png Autonomino y a favor. Para que no nos olvidemos de los rivales de los Rayados del Monterrey. Loko Robles Logo jaguares nuevo.png Discusión 23:13 7 feb 2013 (UTC)

A favor.png A favor Blue box.png The Doctor ¿Who? - 09:09 23 feb 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:00 28 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:43 1 may 2013 (UTC)

Paraguay

Guerra contra la Triple Alianza

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 21:36 22 may 2013 (UTC)

A favor.png Si habrá sido batalla esa.. Alucina.gif Hermética-Logo01.png »Otro Día para Ser 05:01 23 may 2013 (UTC)
A favor.png Pleno al quince, quiero pleno al quince --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:23 23 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 05:54 1 jun 2013 (UTC)

Perú

Machu Picchu

A favor.png Semiautonomino (modificado por un servidor) Blue box.png The Doctor ¿Who? - 20:53 22 may 2013 (UTC)

A favor.png Y.. ¿qué servidor será ese? Ni me lo imagino, aunque tengo mis sospechas.. Loco.gif Hermética-Logo01.png »Otro Día para Ser 05:00 23 may 2013 (UTC)
A favor.png Pleno al quince, quiero pleno al quince --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 13:23 23 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:57 30 may 2013 (UTC) Voto doble. Blue box.png The Doctor ¿Who? - 04:14 30 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 05:53 1 jun 2013 (UTC)

Inkayacu

A favor.png Autonomino a este simpático pajarraco Blue box.png The Doctor ¿Who? - 04:12 14 abr 2013 (UTC)

A favor.png A favor Huellagato.png ::: Deutsche Katze ::: | ::: Diskussion ::: 15:35 16 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:00 28 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 01:04 1 may 2013 (UTC)

Uruguay

El Bananero

A favor.png Pero más bien, loquita!! Digo, autonomino --1559137312 254443 1559137371 noticia normal.jpgSandman-kun EXIT LIGHT! ENTER NIGHT! 20:21 3 may 2013 (UTC)

A favor.png Shegó el bigoteeeee! Gil Culiao (discusión) 04:34 10 may 2013 (UTC)
A favor.png "Con este día debe estar tomando Sol" "Qué trolazo!" Headcrab Ravenholm logo.pngThe Freemaiden 05:00 10 may 2013 (UTC)
A favor.png ¡¡Putas, Harry, putas..!! Hermética-Logo01.png »Otro Día para Ser 05:03 10 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 23:36 13 may 2013 (UTC)
Comentario.png ¡Guau! Y pensé que en ésta nominación todos iban a ser votos con alguna frase del gordo gilazo éste... Flipao.png Alucina.gif Hermética-Logo01.png »Otro Día para Ser 00:15 14 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 05:02 1 jun 2013 (UTC)

Copa Mundial de Fútbol de 1930

A favor.png Nomino y a favor--Alukram Linkespada.jpg Fiebruos por aqui Hyrule 16:10 20 jun 2012 (UTC)

A favor.png A favor Gil Culiao (discusión) 18:07 15 feb 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 01:54 1 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 11:47 3 abr 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 00:49 1 may 2013 (UTC)

Venezuela

Nicolás Maduro

A favor.png Autonomino Blue box.png The Doctor ¿Who? - 03:47 28 abr 2013 (UTC)

A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:01 28 abr 2013 (UTC)
A favor.png Un pajarito me pidió que votara a favor. Gil Culiao (discusión) 20:08 21 may 2013 (UTC)
A favor.png ¡FRAUDE! ¡FRAUDE! TACATACATACATACATACATACA Risa.gif Maraletovio (Peleadera) 00:15 2 jul 2013 (UTC)
Candado.png Destacado Gil Culiao (discusión) 18:08 2 jul 2013 (UTC)

Henrique Capriles Radonski

A favor.png Nomino a ver si el tipo gana una votación alguna vez. Gil Culiao (discusión) 16:23 21 may 2013 (UTC)

A favor.png A favor, pero verás como Maduro gana con una mayoría muy apretada, vendrá Capriles, se nos armará aquí un follón, que si la Inciclopedia está trucada, las votaciones saboteadas, blah bleh blih... --
  1. REDIRECCIÓN Usuario:Marquii/Firma.js 19:37 21 may 2013 (UTC)
A favor.png A favor. Ganó la gobernación de Miranda dos veces seguidas, pero todos saben que esa votación la financió la extrema derecha sionista y nazi (igual que ésta).--Corona de Ricardoxxxlo.png Rix DeLarge Clockwork Orange.gif (Goboree conmigo) »Alex De Large Awesome Face.png Videe mis proyectos llenos de ultraviolencia Naranjamecanica.jpg 23:17 21 may 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 03:52 30 may 2013 (UTC)
A favor.png A favor Blue box.png The Doctor ¿Who? - 04:19 30 may 2013 (UTC)
Candado.png Destacado Blue box.png The Doctor ¿Who? - 05:08 1 jun 2013 (UTC)

Televisión venezolana

A favor.png Nomino y a favor--AlukramLinkespada.jpg Hyrule 17:07 19 jun 2012 (UTC)

A favor.png A favor--Fandemampato (discusión) 03:44 18 abr 2013 (UTC)
A favor.png A favor Hermética-Logo01.png »Otro Día para Ser 04:01 28 abr 2013 (UTC)
Candado.png Nacionalizada Blue box.png The Doctor ¿Who? - 00:52 1 may 2013 (UTC)